Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_302H12-3
Clone ID CMHD-GT_302H12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_302H12-3
Sequence
GCCTTCATCTCTGGCCTGCTGGACAAGATCACGGGCATGCTGAAGCTGAGCACACCCCAGAAGAAGTGAGGGTCCTGACT
CAGGTGGCCGTGGCTCCCACAGGACAATCGCTGCCCCCCAACCTCATAGCAACAGCAATACCGGGGGACCCTGTAGCCAG
GCCTGGTGCCATGAGCAGGGATCCCCTTGCCCCTGCCTAGGGGTCATTTCCCTTGCCCTCAGTTTTCCACTTTTGGGGGG
TTTTATTGTTATTAAACTGACGGGACTTTT
Sequence Type mRNA
Unitrap ID UNI13519

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 99373332..99373601 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000084142 (AL807784.11-206)  

 
Come back to gene ENSMUSG00000084142


For any suggestions or comments, please send an email to unitrap@crg.es