Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13033B10
Clone ID IST13033B10
Vector VICTR76
Project tigm

Sequence tag IST13033B10BBF1
Sequence
AAAGGACATATCATCTTTTCTCTGCGCAGAGACTTCCTGTGACTTCCCCTCGCCCAGAACAAAAACCAAGAACATCTCAC
CTAAAACCTGGTCCCTCCCCTGTCTTCGACTCCTGCCTTCTGCCACTCTTTACCTTACCCACCCTTTCCACACGGTGATG
TGCCCCCTCATGGCCTCCCCCTGTCCTCTTTCCACAGAAATGTGAGAGCTTCTTGTCCCCTGAGTTCCGCTCTTTTGCGG
TGGATCT
Sequence Type genomic DNA
Unitrap ID UNI33676

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7751388..7751633 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039201 (Tbc1d25) NM_172478 TBC1 domain family, member 25 Gene [Source:MGI (curated);Acc:Tbc1d25-001]

 
Come back to gene ENSMUSG00000039201


For any suggestions or comments, please send an email to unitrap@crg.es