Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_301C6-3
Clone ID CMHD-GT_301C6-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_301C6-3
Sequence
CTTTCAGTCCCTGGAGATGTTGAAGCATTTATGATGGTGCATGGCCAAACTTAAGCTATGCACCTGAAGCCATAGTTTCT
TCCTCACCAGAAGTGATGGTTCAGTTGTGAGGCAGCCCTCCAGCAAGACATTGTAAAAGTGTTTCAATTGTTTAATAAAA
GGTCAAGTATCTG
Sequence Type mRNA
Unitrap ID UNI13525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84509382..84509554 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000076437 (2700094K13Rik) NM_001033166 RIKEN cDNA 2700094K13 gene Gene [Source:MGI Symbol;Acc:MGI:1919907]

 
Come back to gene ENSMUSG00000076437


For any suggestions or comments, please send an email to unitrap@crg.es