Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_301C5-3
Clone ID CMHD-GT_301C5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_301C5-3
Sequence
AGGGTTTGGCGGTACCAGCAGCAGTGATGCCCAGCAAAGCCTCCAGTCCTTCTGGCCCAGAGTCATGGAAGAAATCCGAA
ACTTAACAGTGAAAGATTTCCGAGTACAGGAACTCCCACTGGCTCGTATTAAGAAGATTATGAAACTGGATGAAGATGTG
AAGATGATCTCTGCTTAATCCCCTGTGCTGTTTGCTAAGGCACCCCAGATTTTTATCACTGATCTGACTCTTCGAGCCTG
GATCCACACAGAGGATAACAAGCGTCGTACTCTTCAAAGGAATGATATTGCCATGGCAATTACAAAATTTGATCAGTTCG
ACTTTCTCATCGATATTGTTCCAAGAGATGAACTGAAACCTCCAAAGCGCCAGGAGGAGGTACGCCAGTCTGTGACTCCT
GCGGAGCCTGTCCAGTACTACTTCACGCTGGCTCAGCAGCCCACTGCTGTCCAGGTCCAGGGACAGCAGCAAGGCCAGCA
GACCACCAGTTCTACGACCACCATCCAGCCTGGACAGATCATCATTGCACAGCCTCAGCAGGGTCAGACCACACCCGTGA
CCATGCAGGTTGGAGAAGGTCAGCAGGTGCAGATTGTACAGGCCCAACCTCAGGGTCAGGCCCAGCAGACCCAGAGTGGC
ACTGGACAGACCATGCAGGTGATG
Sequence Type mRNA
Unitrap ID UNI13526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120437861..120463072 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032897 (Nfyc) NM_008692 nuclear transcription factor-Y gamma Gene [Source:MGI (curated);Acc:Nfyc-002]

 
Come back to gene ENSMUSG00000032897


For any suggestions or comments, please send an email to unitrap@crg.es