Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11633G9
Clone ID IST11633G9
Vector VICTR76
Project tigm

Sequence tag IST11633G9HMF1
Sequence
TGCCTAGTAGTGCTGTGGAGTGTTGCCCTTTTCACAGAGCATGGCTTGTCATTCCCAAAGCTAGAGCCTGCATCTAAGCC
TGCTGCTGGCCTGCCTTCCTCACCGCCCTCCCCCACCCCCGCAACTAATTCATGTGTTGAGGTTTTGGTGGATCTCACCA
TGGGAATTTGAGGTATCTGTGGGCACGTATAGAAGCTGGGGTTCTGAGGTCTCTTTTGTGGCTCTTGTTCANCACCNNAC
CCACATCCCACCTACTGCATGTGGA
Sequence Type genomic DNA
Unitrap ID UNI5026

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 118621361..118621624 258
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30110745..30111008 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


Sequence tag IST11633G9HMR1
Sequence
GGCAGGGTCAAGTTGAGCAAGAAAGAGGAGGAAGGAAATGTTTGTTTTATTCATGACTCTTCTCATGTTGAATAATTTCT
TTTTAATGACTGCGTTGTATGTGGAATCCACAAACAAATGCAAAATGCCACTAATCCCTTTACCAAATGCAGCTCCCTCT
TCAGAACAAACTTTAAGGCCACAAGAACCCAGGTTGTGGTCTGCTGGCCGAACACAACAATTGACTACAGGACACACAGA
GCCCGGTGACTTNNCAGCCTGATTGGATCTCTGTATANCCCTGGCTGTCCTGGAACTCACTTTGTANACNNNGCTGGCCT
CNANCTCNNANNTCCNCCTGCCTNTGCCTNNNGAGTGCTGGGATTANAGGTGTGNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es