Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_301G3-3
Clone ID CMHD-GT_301G3-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_301G3-3
Sequence
ACTTCCATCGCTGCTGCTTCCTGTGCATGGTTTAAAAGAAAAATTTAGACAGCACAACAGTGGCGATTCATGATGAAGAG
ATCTACTGCAAATCCTGCTACGGAAAGAAGTATGGACCAAAAGGCTATGGTTATGGCCAGGGCGCTGGCACGCTCAACAT
GGACCGCGGTGAGAGACTGGGCATCAAGCCAGAGAGTGCTCAACCTCACAGGCCTACGACAAATCCAAACACTTCTAAAT
TTGCCCAGAAATATGGAGGAGCTGAGAAGTGTTCCAGGTGTGGGGATTCCGTGTATGCTGCGGAGAAGATCATTGGAGCT
GGGAAGCCCTGGCACAAAAACTGTTTCCGGTGTGCCAAGTGTGGGAAGAGTCTGGAGTCTACAACTCTGACTGAGAAAGA
AGGCGAAATCTACTGTAAAGGGTGCTACGCAAAGAACTTTGGGCCCAAGGGATTTGGCTATGGTCAAGGGGCAGGGGCCC
TTGTTCATGCTCAGTAATGGTGTGAACCCAGTAAGCACGACAGAGAATCTCCATTACCAAACTGCAGATGGCGTTTATGG
CGCTCACTACTGTGAAACAGCCAGCACTTGGCACTGGGCATCACCGAGCTGCCTGTGGGGGCTGGACCGACAGCGCTGCA
CTCTCCCGCCCACTCACTAGCGTCTAAGAGCATTCTTTTACAT
Sequence Type mRNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110369098..110376529 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es