Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13485F2
Clone ID IST13485F2
Vector VICTR74
Project tigm

Sequence tag IST13485F2BBF1
Sequence
CAGAGTTCAAATCCCANCAACCNCATGGTGGCTCACAACCATCCATAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31200 UNI31201 UNI33691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7555543..7555599 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 38507013..38507069 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 55888262..55888318 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22419322..22419378 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 70598883..70598939 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73376079..73376135 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3520389..3520445 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32517629..32517685 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020272 (Stk10) NM_009288 serine/threonine kinase 10 Gene [Source:MGI (curated);Acc:Stk10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 34941208..34941264 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 42311796..42311852 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61181423..61181479 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020085 (Aifm2) NM_001039194 apoptosis-inducing factor, mitochondrion-associated 2 Gene [Source:MGI Symbol;Acc:MGI:1918611]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 64829297..64829353 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72736122..72736178 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16983803..16983859 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 144842680..144842736 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 107535578..107535634 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028613 (Lrp8) NP_444303 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor Gene [Source:MGI (curated);Acc:Lrp8-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142339959..142340015 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71521031..71521087 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 88846454..88846510 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 15791814..15791870 53
NO GENE  


Sequence tag IST13485F2HMF1
Sequence
CAGAGTTNAAATCCCAGCAACCACATGGTGGCTCACAACCATCCATAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGA
ANACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTAAAAAAAT
Sequence Type genomic DNA
Unitrap ID UNI544 UNI36262

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14742409..14742537 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 122277228..122277356 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57736430..57736558 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 81253847..81253975 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 70777838..70777966 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 42311796..42311924 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 45947382..45947510 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3300546..3300674 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5350826..5350954 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42039868..42039996 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 88846454..88846582 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108397439..108397567 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034557 (Zfyve9) NM_183300 zinc finger, FYVE domain containing 9 Gene [Source:MGI (curated);Acc:Zfyve9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 144842680..144842808 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 90064366..90064494 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 64829297..64829425 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67295640..67295768 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 156094521..156094649 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040990 (Sh3kbp1) NM_021389 SH3-domain kinase binding protein 1 Gene [Source:MGI (curated);Acc:Sh3kbp1-001]

 
Come back to gene ENSMUSG00000040990


For any suggestions or comments, please send an email to unitrap@crg.es