Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14747C6
Clone ID IST14747C6
Vector VICTR76
Project tigm

Sequence tag IST14747C6HMF1
Sequence
CACACACAAGCCCTTATCCATACATGGTAAACATCTCAATGTAAGGATCTCTTCTTCTCTGACCTGGTCTCCTAGCAGAT
AGCCTGAGAGCTCTGTCCTCAAACACCCACGTGTGATACTTACACAGCACTGCCAGTCCTGTGGGTCCAGATCCAGGGTA
GGGAGTCAGTGCAGACCTCAGTTCATTTTCTAAGCAGCCATGCCTGACGGCCTCAGGCTGCCACATTGTGTTGTTTGTGT
GTCCACACCTCCTCACCCAGGTCCCCATTCTGTGCCTTTATCTGAAGGAGCATATACAGTATCTGCCCCCACTCTCTGCG
AGGGAATCTGAATTTCAGATCTAACTGGGTCTCCTTTATTTTCACTGACTAAATATAACAACTTTGACCCAAGANACTTG
TGTCAAACCTAAGCACAGCATTATTGTGTGTTCCTGCTATTCTGGCCNTGTTA
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114295138..114295589 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST14747C6BBF1
Sequence
TGCTCTTGGTAGACTCCAGGTCCTGTGGACACACACAAGCCCTTATCCATACATGGTAAACATCTCAATGTAAGGATCTC
TTCTTCTCTGACCTGGTCTCCTAGCAGATAGCCTGANAGCTCTGTCCTCAAACACCCACGTGTGATACTTACACAGCACT
GCCAGTCCTGTGGGTCCAGATCCAGGGTAGGGAGTCAGTGCAGACCTCAGTTCATTTTCTAAGCAGCCATGCCTGACGGC
CTCAGGCTGCCACATTGTGTTGTTTGTGTGTCCACACCTCCTCANCCANGTCCCNATTCTGTGCCTTTATCTGANNGANC
ATATACN
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114295293..114295618 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST14747C6HMR1
Sequence
AGCAAAGTCCAGNAATAGATGCTAAGGGGGCGGCAGCAACAAGTTACAATCACAGATGCAACTCAGTTCTCAGGAAGTCC
ACTGAAGATCAAGACAGCCACTGGCAGCTGCTAAGAGGATCCTGTGACAGCTTGCTCTATATCCAAGAGGTGAACCAGAG
ACAAACCTTTCGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114295615..114295787 170
 
EST/CDNA Est Name
  CJ217958.1 - CJ216410.1 - CJ218029.1 - CJ218443.1

 
Come back to gene CJ217958.1 - CJ216410.1 - CJ218029.1 - CJ218443.1


For any suggestions or comments, please send an email to unitrap@crg.es