Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10492F9
Clone ID IST10492F9
Vector VICTR76
Project tigm

Sequence tag IST10492F9BBF1
Sequence
GGAGTATTTGTCTTTCTGATAAATAAACCAGAGGCTTGCAGCAGTGGGACAAAGCCTGACTTCTGTGACCTTGAACCACT
GCCAGGCTGAACAGGATTTGTTTACCATTGTAAATTGACCACAGTCAATTGTGTCTTCAGAGGAAGAGGTGTAGAGACCT
GCCTTANCAAACTTAAAAACTTACAAAAGAGACCTAGTCATTCCCTTCTCCATTCANAAATTCTTTCTCTTTATGGACTT
ATTTGTCATTCCTGTGGACGGTTTTATAAATGATGTCTTACGGGGAGAGAGATGGCTCAAGANGTTAAGCGCGCTTGAAN
AGAACCTGAGTTCAGATCCCAGAACATACATGGTGTCTCCTAACCATCTGTAACTCCNACTCCAGGGAAACCCAGTGTCC
TCTTCTGGCCTCCGTGTGCAGTGCACACATGTACGATTGCATACNTGCCGGGANANAGACTCATAAAACAACAAANGTTT
ANAGTCTGNCTTAAAGCNNGGTGAAGCGGTGCACNCCTTTAATGCCCGCCCCCGNCCTCTCTCTNTT
Sequence Type genomic DNA
Unitrap ID UNI2700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125122137..125122682 513
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038252 (Ncapd2) NM_146171 non-SMC condensin I complex, subunit D2 Gene [Source:MGI Symbol;Acc:MGI:1915548]


Sequence tag IST10492F9HMR1
Sequence
CACAGGCTGGTAAGAGGGGTGTGTTGTGTGTGTTCNNATNACTCAAACAGAGGCCTCCTCAGCAGGGCCCGTGTCTTACA
CTAAACGAACAGTCANTCCATATGTCCTAACACCTTGCTGGGTGAGCATGGGTAGACTGGGACATCTTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125122728..125122879 144
NO GENE  

 
Come back to gene ENSMUSG00000038252


For any suggestions or comments, please send an email to unitrap@crg.es