Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14397C7
Clone ID IST14397C7
Vector VICTR74
Project tigm

Sequence tag IST14397C7HMR1
Sequence
TGTCTNATCCCTAGGTTGGTGCCGGTATCGGGCACTTGTTTCTGGTGATTGGGGGTTTCTCCGTAGCTATTAAGGTGGTC
ACCTGTGGAAACAGCAAGCCNGTGGAGCTGTCTTAGATTCCNCANNCCACATCTCTTGGCN
Sequence Type genomic DNA
Unitrap ID UNI30096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86591773..86591912 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031706 (Rfx1) NM_009055 regulatory factor X, 1 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:105982]


Sequence tag IST14397C7HMF1
Sequence
ACAGCACACCAGAGAACAATTTGGGATCCTCTACATCTCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86591731..86591775 45
NO GENE  

 
Come back to gene ENSMUSG00000031706


For any suggestions or comments, please send an email to unitrap@crg.es