Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14471C2
Clone ID IST14471C2
Vector VICTR74
Project tigm

Sequence tag IST14471C2HMR1
Sequence
TTATAAAAGGAANCATTTAATTGGGCTTATATTCCCAGAGAATAGAGCCCATGATGGCGGANCAAAGGCCGGGCAGCAGG
AACAGCTGAGTGCTCGCATCTCGACCTGCAAGTAGGAAACTGTACAAACACAGGGAACAGCATAAGTCTTTTGAAACCTC
AAAGCCTGCCCCAGTGGCACACCTTCCTGAACAAGGCTTTGGCTAATCTTGCCCAAACAGTTCCACAAGCATGAGGGCCA
TTCTCATTCAAACGTCCACGTTCTACTCCCTGGCCCCATAGGCTTGTANCCATATCTTAATACGAAATGCATTTANTCTA
ACAACAAAGGTTGGACN
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60654076..60654411 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]


Sequence tag IST14471C2HMF1
Sequence
GTCACAGCAATAGAGAAGTAACTAAGATACTGTCCACCCAGGACTAACAGGACACATCCTCAGCCCACTGTCTGTGAGGT
GTGTCCACAGCTGCACTCATTCGTTCTGTCAAGCCATGTCAGAGGCAGACACACAATAAATTAGACATCAGGGCCAACTC
TCCACACTAACTCAGTATAACCATCATGGGAAAGACATTCACAGAGCAAGCCATTTTACTGATGAGCCGGGTTCAATTAT
GACATAATCTCCCCAAGTACGTGAAAATGTTTATACGCTGTGCTACATAGTTTTAAGGAAGGAACCTCAACTGANAAAAT
GCCTCCTTAANATCCAGTTGTAAGGCATTTCGTAATTAGTGACTTATGCAGTGCATTGCGGGTGGTGCCNACCCTGGGCA
AGTGTTCCNGGGTTCTGNAANNNANCNTGCNNANCANNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60653634..60654053 410
NO GENE  


Sequence tag IST14471C2BBF1
Sequence
GTCACAGCAATAGAGAAGTAACTAAGATACTGTCCACCCAGGACTAACAGGACACATCCTCAGCCCACTGTCTGTGAGGT
GTGTCCACAGCTGCACTCATTCGTTCTGTCAAGCCATGTCAGAGGCAGACACACAATAAATTAGACATCAGGGCCAACTC
TCCACACTAACTCAGTATAACCATCATGGGAAAGACATTCACAGAGCAAGCCATTTTACTGATGAGCCGGGTTCAATTAT
GACATAATCTCCCCAAGTACGTGAAAATGTTTATACGCTGTGCTACATAGTTTTAAGGAAGGAACCTCAACTGAGAAAAT
GCCTCCTTAAGATCCAGTTGTAAGGCATTTCGTAATTAGTGACTTATGCAGTGCATTGCGGGTGGTGCCAACCCTGGGCA
AGTGTTCCTGGGTTCTGTAANAAAGCATGCTGANCAAGCCAGGGGGANCAAGCCAGTAAAGAGCACCCCTCCNTGCNNNN
GCATCNGCTCCTGCCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60653557..60654053 479
NO GENE  

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es