Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14568E8
Clone ID IST14568E8
Vector VICTR74
Project tigm

Sequence tag IST14568E8HMR1
Sequence
ACAGAAAGACAGAAAAACAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAA
G
Sequence Type genomic DNA
Unitrap ID UNI16186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 20728063..20728141 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044393 (Dsg2) NM_007883 desmoglein 2 Gene [Source:MGI (curated);Acc:Dsg2-001]

 
Come back to gene ENSMUSG00000044393


For any suggestions or comments, please send an email to unitrap@crg.es