Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13670G2
Clone ID IST13670G2
Vector VICTR74
Project tigm

Sequence tag IST13670G2HMF1
Sequence
CCATGCAGAAGCCTCAGGAAGAATACAGCATCGGCGTGCTTGACATCTACGGCTTTGAGATCTTCCAGGTTTGGCTCTGG
CTGCCCCTCACCCTCAGCCCAATCCTGTCTGTCTGTCACCTAGGCTCACCCAGTATTTGCCANANACATTGCATAGCCCA
CTAACAGAAAGGCCCTTTCCTCTCCTCCACAGAAAAATGGCTTTGAGCAGTTCTGCATCAACTTCGTCAATGAAAAGCTG
CAGCAGATTTTTATTGAGCTCACGCTGAAGGCAGAGCAGGTGGGCAGGGCAGCCAAGTGTCACAAGACAGCACGTCAAGC
CTAAGGGTCTCTATGCCACTGAGGACCCCCACACACAAATTCATTCCACCTCTCTCTGCTCGCTGCATTANATTCANCTT
CCTGCTACTATAACAAAATACCACATATAATTTATAAAGAGAANNGGAAAGCTAGGAATGCCNTTCNNTTGGTNAAGCGC
ACTTGCCTANCATGCNTNAANGTGTGANTTCCATN
Sequence Type genomic DNA
Unitrap ID UNI33693

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33720643..33721156 482
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]


Sequence tag IST13670G2BBF1
Sequence
CCATGCAGAAGCCTCAGGAAGAATACAGCATCGGCGTGCTTGACATCTACGGCTTTGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32805

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33720643..33720705 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es