Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_300D6-3
Clone ID CMHD-GT_300D6-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_300D6-3
Sequence
GTCAGCCATGTCATCTGAGCCTCCTCCACCGCCGCTGCAGCCCCCCACGCATCAGACTTCTGTAGGGCTATTGGATACCC
CTCGCACCCGGGATCGCTCTCCATCCCCCCTGCGGGGCAATGTGGTCCCTAGCCCTCTGCCTACCCGCCGGACAAGGACC
TTCTCAGCGACAGTGCGGGCTTCGCAGGGCCCCGTCTACAAAGGAGTCTGTAAATGCTTCTGCCGGTCCAAGGGCCACGG
CTTCATCACCCCAGCTGATGGTGGTCCTGACATCTTCCTGCACATCTCTGATGTGGAAGGGGAGTATGTTCCGGTGGAAG
GCGACAAAGTCACCTATAAGATGTGCTCTATCCCACCCAAGAACGAGAAGCTGCAGGCTGTAAAGGTGGTCATCACCCAC
CTGGCACCAGGGACCAAGCATGAGACCTGGTCTGGGCACGTCATCAGCAACTAGGGACCTGCAAGAACCCCTTCTCCTGG
GCTTGAGGGAGACTTTGGGGGAAGGAGGAGCAGGGCCATCCTGGATAGAACATTCTACCATACAAGATGGGGCCTCAAGG
CGGGCGTGGCCCCTCTCAAGCATTTCCTGGAGGGAAGGAGTTGCGGGCAGGCAAGGGGTGCTCTCAGCCACCAGTGCAGC
CTCCAGCCATTGCAACAAGCTCTCACTGTCTGAAAAGCATTAAAAGCATTTGAAAAG
Sequence Type mRNA
Unitrap ID UNI13542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8660791..8664515 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008393 (Carhsp1) NM_025821 calcium regulated heat stable protein 1 Gene [Source:MGI Symbol;Acc:MGI:1196368]

 
Come back to gene ENSMUSG00000008393


For any suggestions or comments, please send an email to unitrap@crg.es