Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_300C8-3
Clone ID CMHD-GT_300C8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_300C8-3
Sequence
TGCTGTCCCCGGCATAGGTCCGTCTCTGCAGAAGCCTTTTCAAGAGTACCTGGAGGCGCAGCGGCAGAAGCTTCATCACA
GAAGTGAAGCGGGCACACCACAGGGAGAAAACTGGTTATCCTGGATGTTTGAGAAGCTGGTGGTTGCAATGGTGTGTTAC
TTTGTCCTGTCTATTATTAACTCCATGGCACAAAACTATGCCAAACGAATCCAGCAGCGCTTGAACTCAAAGGAGAAAAC
TAAATAAGCAGAGAGTTTTTATCTGCAGAAGTTAACATGGTGGAGTCCTGCCTTACACTGGGAGGGCTCTAACCAGGAAG
GAAGGTCCCCGTTTCCAACCTGTGTTGATTTTTAAAACATTCTTCCTGAAAGCAGTTTAGTCCATATGTTACACTGACAT
ACTTTATTTGTTAAGGTAAGGTGTCTACACCCTCAGTTCAATCCACGTCGTATTCTTTAGGGTGGATGTGATGTTCTGCT
GCAAACTTAACAAAAACTGGCCTTCTGATACCTTCACAGGGCCACACAGAACCTTCTGAAGTATGTTAAATATGTCAGGC
TTTTTAGGCTTGTCACAAATGATTGTTTTTTTCTAAGTCACCAAATGTATATAAGTTATATATATTGGATAGCAATCTTG
CATGTCTATCATGGAACAATTTAATATGCCTTCCTTTCCCACCCTCAAAAAGGCCATTTTATGACGCATTGCACACCCTC
TGGGGAAATTGATCTTTAAATTTTGAAACAGTATAAGGAAAATCTGGTTGGTGTCTCACAAATGAGTACGCCATTTTTTA
TTCTGTATATTT
Sequence Type mRNA
Unitrap ID UNI13547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86398245..86400100 711
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es