Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14564E1
Clone ID IST14564E1
Vector VICTR74
Project tigm

Sequence tag IST14564E1BBF3
Sequence
NNGNNACACTAGGCAAGCTAGGCCCTCCACTGGGCCAGAACAGGCTCTCAGTTGCCAATACTTGCTTTAAGGGAACTTTA
GCACAGGCAGACTGAATTTCCATCTTCCTATCTCAGCCTTCCAAGTAGCTGGGACTGAAGGCCAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 111936693..111936838 146
NO GENE  


Sequence tag IST14564E1HMR1
Sequence
CAGCCTCTTTATCTCTGTCTGTCTCCCCCTCTCTCTGCTTACCCTCATGCCTCCAGTGGAGTAGGGAGGGTCAACGTGGG
GAGAGAGTTGGACAGTGTAGGGACAGGTGTGGAGGACACCTGAGGGTGGATGTCTGTTCTGGGCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI33695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86425959..86426107 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013033 (Lphn1) NP_851382 latrophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1929461]


Sequence tag IST14564E1HMF2
Sequence
TTNNNNCANNTCNANGCNGNNNNCANANNANGTGACNTANTCCNNANNCCCCANCACTTGAAAGGCTNANATTGTANGAC
TACANANCTACNNTGTTGGANGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000013033


For any suggestions or comments, please send an email to unitrap@crg.es