Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_300C5-3
Clone ID CMHD-GT_300C5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_300C5-3
Sequence
GCCCCTGCCCGGCCTGCCTCTCACCCCCTGCAGATGGGGCCCTGCTCCTATGAGATCAAGCAGTTCCTGGACTGCTCCAC
CACTCAGAGCGACCTAACCCTGTGTGAGGGCTTCAGCGAGGCCCTCAAACAGTGCAAATACAATCACGGTCTGAGCTCCC
TGCCCTGAAGAGGCTGTGGGCCTGCTCATCGCCTAACCCCTCACCGACAGCTTGATGGAAAGGAGAGGTTCCATGTGACT
GGGAGTAAGGAAGGATCGTTCTCACCCCGCAAACTAACAGGAGACATAATTATTCAATTAAAAAGTTTACTTTAGACC
Sequence Type mRNA
Unitrap ID UNI13550

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75400052..75400489 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049422 (Chchd10) NM_175329 coiled-coil-helix-coiled-coil-helix domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2143558]

 
Come back to gene ENSMUSG00000049422


For any suggestions or comments, please send an email to unitrap@crg.es