Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_300A8-3
Clone ID CMHD-GT_300A8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_300A8-3
Sequence
AGAAAGGTCTGTCCTTCTATGTCACAGTGGGGGTCGGTGCAGGAGGACTCCTCTTGGTGCTCTTGGTGGCGCTTTTTATT
TTCTGTATCTGCAAGAGGAGAAAACGGAACAGGAGGAGAAAAGATGAAGAGCTGGAAATAAAAGCTTCCAGAACAAGCAC
TGTGGAAAGGGGCCCCAAGCCGCACTCAACCCCAGCCGCAGCAGCGCAGAATTCAGTGGCGCTCCAAGCTCCTCCTCCAC
CTGGCCATCACCTCCAGACACCTGGCCATCGTCCCTTGCCTCCAGGCCACCGTACCCGTGAGCACCAGCAGAAGAAGAGA
CCTCCTCCATCAGGCACACAGATTCACCAGCAGAAAGGCCCTCCTTTACCCAGACCCCGAGTTCAGCCAAAACCTCCCTG
TGGGAGTGGAGATGGTGTTTCACTGCCGCCCCCTAATTAAGAAGGCAGAGTTCGTCATTTCCAATAAAAAGCTGTGTGGA
TTTATCTTCTTCAAG
Sequence Type mRNA
Unitrap ID UNI13551

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101079827..101083833 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027863 (Cd2) NM_013486 CD2 antigen Gene [Source:MGI Symbol;Acc:MGI:88320]

 
Come back to gene ENSMUSG00000027863


For any suggestions or comments, please send an email to unitrap@crg.es