Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_300A1-3
Clone ID CMHD-GT_300A1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_300A1-3
Sequence
TTGCAGATGTCAAAAAAGATTGGTCGGACCATGCTCTCTGGTGGGAAAAGAAGAGGACTTGGCTGCTTAAGACACACTGG
ACCTTGGATAAGTGTGGCATCCAGGCAGATGCCAAGCTCCAGTTCACCCCGCAGCACAAACTGCTCCGCCTGCAGCTTCC
CAACATGAAGTATGTGAAGGTGAAAGTGAACTTCTCTGACCGAGTCTTCAAGGCTGTGTCTGACATCTGCAAGACTTTCA
ATATAAAACACCCTGAAGAACTTTCTCTCTTAAAAAAACCCAAAGATCCC
Sequence Type mRNA
Unitrap ID UNI13552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46102192..46124407 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037712 (Plekhc1) NM_146054 fermitin family homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Plekhc1-001]

 
Come back to gene ENSMUSG00000037712


For any suggestions or comments, please send an email to unitrap@crg.es