Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14505E2
Clone ID IST14505E2
Vector VICTR74
Project tigm

Sequence tag IST14505E2HMF1
Sequence
CATAAGCTGTCATCTGACCTTCACATGCATGCCTGTGTGCTCCCAACCAACACAGACACACAGACNCNCNCACACTACTC
CAAATAGCTCTTGTGCCACCACCTCTACACCTAGCATGCACTATCCTCAAAATTCTCAAACCCAAGCTGGCTTCAAACTT
GTGTGTCTTAATGCTGGAACTGGANGCATTCACTAACCATACCTGGCTTACACTTTTATTTTTACAGAGGCATTGTCN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84839527..84839763 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14505E2HMR1
Sequence
NTTTATGTATGAGTACAATTATAGCTGACTTCAGACAAACCANAAGAGGGTGTCAGAACCCATTACAGATGGTTGTGAGC
CACCATGTGTTTGCTGGGAATTGAACTCAGGACCTTTGGAAGAGTAGTCAGTGCTCTTAGCAGCTGAGCCATTTCTCCAG
CCCTGACCGATTTTCAGTCCTGTCAAAATGTGACTCATCTGAGCCTTGTGCATTTTCAAAATATCTTAGAAGATGTGAAA
CGCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI29519

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40502223..40502469 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]


Sequence tag IST14505E2BBF1
Sequence
CCATAAGCTGTCATCTGACCTTCACATGCATGCCTGTGTGCTCCCAACCAACACAGACACACAGACNCNCNCACACTACT
CCAAATAGCTCTTGTGCCACCACCTCTACACCTAGCATGCACTATCCTCAAAATTCTCAAACCCAAGCTGGCTTCAAACT
TGTGTGTCTTAATGCTGGAACTGGAGGCATTCACTAACCATACCTGGCTTACACTTTTATTTTTACAGAGGCATTGNNNN
NANNNNNNNNNNNNNNNTAAAGCACACCAGCTGTGGTGGCACTCAACTTTAATTCCAAGACTTGGGAGGCAGAGGCAGGT
GGATCTCTGANGCTANCANANACTGGTCTACAGAGTGAGTTCCANACCANTCNNNGTTACATANANNAACCTTGTCTTGA
AAAACCANCCCCNCCCCCCNANNANAAN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84839526..84839944 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es