Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14447G8
Clone ID IST14447G8
Vector VICTR74
Project tigm

Sequence tag IST14447G8HMR1
Sequence
TATTATCGCCTCTCCCAAACCCCCAAGTTTCTCGGAGAACCAGGATTTGAGGACGGTTTCCTTCTCTGCATGTCCGAGGA
GTCCCAAAACACGAGATTCCCTCCT
Sequence Type genomic DNA
Unitrap ID UNI536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114471242..114471346 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]

 
Come back to gene ENSMUSG00000079259


For any suggestions or comments, please send an email to unitrap@crg.es