Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12421F12
Clone ID IST12421F12
Vector VICTR76
Project tigm

Sequence tag IST12421F12BBF1
Sequence
TGTATAGCCCTGACTGTCCTGGAACTCACTTTGCAGACCAGGCTGGCCTCAAACTCAGAAATCCTCCC
Sequence Type genomic DNA
Unitrap ID UNI19577 UNI30261 UNI31913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 45114418..45114484 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10552847..10552913 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 27131817..27131883 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62664371..62664437 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4550951..4551017 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69313994..69314060 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 88468763..88468829 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 76093500..76093566 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60950442..60950508 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108261268..108261334 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 40495998..40496064 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109795343..109795409 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93118410..93118476 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32681404..32681470 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 70394598..70394664 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7564242..7564308 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 98373391..98373457 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 70461019..70461085 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053153 (Spag16) NM_029160 sperm associated antigen 16 Gene [Source:MGI Symbol;Acc:MGI:1913972]


Sequence tag IST12421F12HMF1
Sequence
TGTATAGCCCTGACTGTCCTGGAACTCACTTTGCANACCAGGCTGGCCTCAAACTCANAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053153


For any suggestions or comments, please send an email to unitrap@crg.es