Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_306B3-3
Clone ID CMHD-GT_306B3-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_306B3-3
Sequence
ATACAAAGACTGTTGAAAATGCTGAAGGCTGTGCTGAAAAACAGCCGAGAGGGAGGAAAGGGAAGCAAGAAGGAAGCAGG
ACGAGACTTTGGCTAACAGACGCCTGCCTTGTCCTCCCGTGTTGACTCTCCTGTGAACAGTTTGGCCACAACACAGGACA
CCTAGCGTGTGAGCTTGGACAAAGGGGTCTCTATGTCTCTTCCTTCATCACCTTTGCGGCCTCGATAATCTCTCCTGACA
CAGCCAATATCTAACAAAAACTCTCCAGGTCCCCTCGGGAAACACAAATAGGGGGAAAACCCCACGGAGCCTGGAGATCC
ATTTATGATCCCGTTCGGAGAAGGGTACACTCCCTCATAGCCCAATGCGACTGAAGAAAAGGCTGATAATGAACCGAGCT
GCTCTCCACCAGCTCAAGAACTGTTGACCAGGCTGGGATTTCTACTGGGAGAGGGGATCCCGATCGCCACACTCATAACC
AAAAAATAGAATGAAAAGAGAGGTGGCGCCCGCCTTTAATCCCACCACATGAAAGAGGATTTCTGAGTTCTAGGCCAGCC
TGGTCTACAGAGTGAATTTCATTTCACTTTTTTTTTTCCCCCCCCCCAAAAAGGGATTTTTTTGGGTTGGTT
Sequence Type mRNA
Unitrap ID UNI13559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59537410..59609296 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es