Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13565A10
Clone ID IST13565A10
Vector VICTR74
Project tigm

Sequence tag IST13565A10HMF2
Sequence
TCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAANATGGTGACCGCTGCTGCTGTGGCTTAGGCCG
CCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCNGAAGGTGGCCGGCTGTCCCCGGCCCACAAAGGGTGCTGCCTCAN
CGCCTCTGTGCTTCCGCCTGTTCCAAAANCTGTCAGGTTCTCTGGCGCACCCTCTNANNTGTTCAA
Sequence Type genomic DNA
Unitrap ID UNI33671 UNI33698 UNI33699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13974634..13974858 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 54281855..54282079 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038591 (Colec10) NM_173422 collectin sub-family member 10 Gene [Source:MGI Symbol;Acc:MGI:3606482]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59208798..59209022 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055254 (Ntrk2) NM_008745 neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 103650266..103650490 207
 
EST/CDNA Est Name
  W35784.1 - AA122993.1 - BF149834.1 - AW259852.1 - CD553570.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 10785235..10785459 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 46638739..46638963 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 27504731..27504955 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024211 (Grm8) NM_008174 glutamate receptor, metabotropic 8 Gene [Source:MGI (curated);Acc:Grm8-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27069237..27069461 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 47554570..47554794 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8451211..8451435 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 55794041..55794265 207
NO GENE  


Sequence tag IST13565A10BBF1
Sequence
TCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGTGACCGCTGCTGCTGTGGCTTAGGCCG
CCTCCCCAGCCGGGCGGGCACCTGTCCTCAGGTCCGGACGGTGNCNNNNTGNCCCCGGCCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024211


For any suggestions or comments, please send an email to unitrap@crg.es