Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14025A12
Clone ID IST14025A12
Vector VICTR74
Project tigm

Sequence tag IST14025A12BBF1
Sequence
NTANTTGANTCTGTTTANANATTGNTCNTCTGGTGATTCTGTTACCGTCTATCANCANACCTGGGAGACAGATTCTCTCC
TCTGAGTTTCAGTGCTCAGAGCACTCTCTGCTGGCAAGCTCTCTTACAGGGAAGGTGCGCAGATATCTTGTATTTGGACC
TCCTCCTGGCCGAAGAAGAAGGCCCAAAACAGGACCTTTCTCANACACTGTGTTGCTTTGGCAGTTCCCAGGTGGTACAN
ACTCTCACCTAAGCANACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAAATGGCGACCGCTGCTGCTGTGGCTTAG
GTCGCCTCCCCAGCCGGGCGGGCACCTGTCCTCTGGTCCGGAAGGTGGCCGGCTGTCCCCNGCCNNNNNNNGTGCTGCN
Sequence Type genomic DNA
Unitrap ID UNI31344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27523455..27523837 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021879 (Dnahc7l) dynein, axonemal, heavy chain 7-like Gene [Source:MGI Symbol;Acc:MGI:2685130]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 67414583..67414965 359
NO GENE  

 
Come back to gene ENSMUSG00000021879


For any suggestions or comments, please send an email to unitrap@crg.es