Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12668B3
Clone ID IST12668B3
Vector VICTR76
Project tigm

Sequence tag IST12668B3BBF1
Sequence
NTGNNNNNNANNNGAANNTTAAAATTANTTGTGTNANNNNNTNNNANCTGTAATTTTGCCTTTGTTACNANTCANAATGT
AAATACCTGTGTTTTCCNATGCTCTTAGGCGACCCCTGTGAAANGGTCNNTCNATCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12668B3HMF2
Sequence
GTCTTAAAGAAAGGAAATTTAGAAAGAAAGGGGAGAGGGAGAGGGCTACCTGTGAAGGAAGTCTAGGCTGGTCTTGAAGT
GGCCGTCTTTGCCCCAGCTTCCTGAGTGCTGATGTCAGAAGCATTAGCAGGCAATGCCTGGCTTTGCTGTTGTGCTTTGT
TGTAGCGTTGGCAATTTTTTGCTTGCTTTCCTGTTGAGTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI14388

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87266712..87266914 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010342 (Tex14) NP_113563 testis expressed gene 14 Gene [Source:MGI (curated);Acc:Tex14-001]

 
Come back to gene ENSMUSG00000010342


For any suggestions or comments, please send an email to unitrap@crg.es