Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14815H3
Clone ID IST14815H3
Vector VICTR76
Project tigm

Sequence tag IST14815H3HMR1
Sequence
NGGCGNNNNNNTTGTTGTGGAAGCCTTANCTGCTCCGCTGGATTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI25300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154713859..154713895 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]


Sequence tag IST14815H3BBF1
Sequence
TTACCCCTCTGAGGAGCTGCCCCTAGAGCCCAGGCCATTCCAGCTGGTGACAACCCCTCCCCCAAATATACCCAGGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116476503..116476579 77
NO GENE  

 
Come back to gene ENSMUSG00000074656


For any suggestions or comments, please send an email to unitrap@crg.es