Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13121E9
Clone ID IST13121E9
Vector VICTR76
Project tigm

Sequence tag IST13121E9BBF1
Sequence
AGGTTCTCTGGCGCACCCTCTCACCTGTTCAGACTAATTTCCTAAGTTCGGCGGGTCTCGGACCAAGATGGCGACCGCTG
CTGCTGTGGCTTANGCCGCCTCCCCAGCCGGGCGGTGTTTCATGGTCTTAATANGCCTATCTTTCTACATCTTAACAGTT
CANAAATTANGATGGATGTCATAAGCCANACTTTTGAATCATGTGTAAATTTAACCAATACAGTCATCCCTTCACTGGTT
GCACAGTAACTGCCTATTTGCATTGAAAGGANGACGGCCTANATTCAAGAATGTCAATAGCATTGACAAGTGCATCTGGG
GAAGCCGGAACTGTGGTTCAAATTCTGTCNAATTCACTTCANNGCCCNNGANTTTAACCTAGCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 93182075..93182458 355
NO GENE  


Sequence tag IST13121E9HMF2
Sequence
AGGTTCTCTGGCGCACCCTCTCACCTGTTCAGACTAATTTCCTAAGTTCGGCGGGNCCCGGACCAAGATGGCGACCGCTG
CTGCTGTGGCTTANGTCGCCTCCCCAGCCGGGCGGGCACCTGTCCTCTGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCA
CACAGGGTGCTGCCTCANCGCCTCTGTGCTTCTGCCTGTTCCAGAANCTGTCAGGTTCTCTGGCGCACCCTCTCACCTGT
TCAGACTAATTTCCTAAGTTCGGCGGNTCCCGGACCAAGATGGCNACCGCTGCTGCTGTGGCTTN
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI33703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 93180803..93181106 292
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 56018355..56018658 292
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35521578..35521881 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 72900448..72900751 292
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 50659188..50659491 292
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 59116519..59116822 292
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 51667490..51667793 292
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 134544730..134545033 292
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 10543386..10543689 292
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 39102202..39102505 292
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 46505987..46506290 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041144 (Dnahc7a) dynein, axonemal, heavy chain 7A Gene [Source:MGI Symbol;Acc:MGI:2685838]

 
Come back to gene ENSMUSG00000041144


For any suggestions or comments, please send an email to unitrap@crg.es