Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13962E2
Clone ID IST13962E2
Vector VICTR74
Project tigm

Sequence tag IST13962E2HMF1
Sequence
ATTGAATGAACCAGATTGGTGCATGCCCCTGGTAGGCCTGGGCCTTTTGTTTTGTTTGTTATTTTCATGGTAAATGGTAA
GATGATTAAGAGCAACTCTGATGAAAAAGCTTGCCCTTCAGGACGAGGAAGGGCCCCTGCCTTTTCTGGAGTAGGAGGCT
GTGTAAGGGAGGAGGTTGGCCCTGGTGGCTTTGGTTTTTCCGGGTGCTGAAGAGGAGGCCTCAGCGGGGCAGGACAATAA
ATGGGTAGCTAGAANAACAAAGAGGGGAGGAGCCCAGGCCTGGTAGAGTGTANAATGGCCGGAAGGGTGTGGCCNGC
Sequence Type genomic DNA
Unitrap ID UNI13129

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 111737320..111737633 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017843 (Ppp2r5c) NM_001081457 protein phosphatase 2, regulatory subunit B (B56), gamma isoform Gene [Source:MGI Symbol;Acc:MGI:1349475]


Sequence tag IST13962E2BBF1
Sequence
CTGAGGCCAGGCNATCTGCCATTGTCAGCTGAAGACAACACAGTGACCCAGTGACCGGGTCTGCTCCGTGGAGGACCAAG
CAATGTTGTGGGCTAAGCAAGGGGAANCTGGCCTCANAATGCTGGCCTCATCCCCGGCCATACTAGGGAGCCACAGAAGG
TTTTAGGGGGAAGGAGAATAGATAGGGTGGAGTGAGGAGGAGTTGTGGAGTGGAN
Sequence Type genomic DNA
Unitrap ID UNI33704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80864983..80865196 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055053 (Nfic) NM_008688 nuclear factor I/C Gene [Source:MGI (curated);Acc:Nfic-004]

 
Come back to gene ENSMUSG00000055053


For any suggestions or comments, please send an email to unitrap@crg.es