Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10906D9
Clone ID IST10906D9
Vector VICTR76
Project tigm

Sequence tag IST10906D9HMR1
Sequence
ACCCTCTCNACCTCCCAAACTTCTTTTTATCCCACCACACCTAANGCATGTTCTGACTCGTTAGTAATTGCTTANTTTGT
AAAGCCGTTCTGGTTTGTTTTGCTTTATGTTTTATGTGTGTGANTTAAAATAACAGGATTTTTTTTTGTNGTTTTTTTNT
TTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10906D9BBF1
Sequence
ACAGGGNTCTGTCNAGGTCNATCGACGGTATCNATTANTCCAATTTAATGGCTATCTTGCCNAAAGCAATCTACANACTC
AATGCAATCCCCATTAAAATTCCAACTCAATTCTTCAACGAATTANAAAGGGCAATCTGCAAATTCATCTGGAATAACAA
AAAACCTAGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 42933452..43122520 116
 
EST/CDNA Est Name
  BF224929.1


Sequence tag IST10906D9HMF2
Sequence
ACAGGGATCCCCTCTCCAGCACTCCACCCTCATTACCTAGTGTCCTTTTACGGGCAACACCTCCTGATACTGTCGCTTTG
GGATTCTGATTTNAACATGATTTTTTTTTCTTTTTTTGACACAGGGTCTCCTTACATAGCCCAAGTTTGGCTNTGACTGG
A

Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126805811..126805970 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es