Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14735H10
Clone ID IST14735H10
Vector VICTR76
Project tigm

Sequence tag IST14735H10BBF1
Sequence
AGCTTACCGGGAACCCCCTGAGTGCACCACATGGAGCTGGAATCGATGCAAAAAGCAAGAGGAATTTATTGTTTCAGTGC
ATATTTATTATATGTAAGTACACTTACACACCAGAAGAGGGTATTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 23161647..23161777 131
NO GENE  


Sequence tag IST14735H10HMR1
Sequence
AAGTCTGGAATTACGAGCGAAGAGGTCTTGACAGTAATAACCATAGCATATGTGGAAAAACCAACAAATAAACAACCTTT
ATTTGACAGATGTAGAAAATGAGAAATTCTTTCCTTGTAAACTGATGTTCTTAGCACGTTATTAACCCAGTTAAGTGCTG
GCAGTGAATAGTGATAGCTGCAGCTATTTTTAAATACTGAGCGCCTAGTTTTCTCCATAACCATAAAGTTGCAAAAATAT
TGCTTTTCATTCCTGTGAAACAGAANAGTTAATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI30172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34721332..34721609 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]


Sequence tag IST14735H10HMF1
Sequence
AGCTTACCGGGAACCCCCTGAGTGCACCACATGGAGCTGGAATCGATGCAAAAAGCAAGAGGAATTTATTGTTTCAGTGC
ATATTTATTATATGTAAGTACACTTACACACCAGAAGAGGGTATTAGATCTCATTACAGATGGTTGTGAGTCACCATGTG
GTTGCTGGAATTTGAACTCAGGACCTTTGGAAGAGCAACCAGCGCTTTTTTTTTTTTTTTTTTTTTTNNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 23161647..23161873 227
 
EST/CDNA Est Name
  AV006096.1 - BY471312.1

 
Come back to gene AV006096.1 - BY471312.1


For any suggestions or comments, please send an email to unitrap@crg.es