Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14397E10
Clone ID IST14397E10
Vector VICTR74
Project tigm

Sequence tag IST14397E10HMF2
Sequence
GGGAGGCAGGGATGGGAGGATTTCTGAGTTTGTGGCCAGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74915973..74916013 41
NO GENE  


Sequence tag IST14397E10HMR1
Sequence
CCCTGCACTTGTCTATTTCTCCACAGTTGTGGGCAGAACAAATGAGACAGTTAAGCTACTTCACAAAAAGGCAGGGCAGC
TGCTATAGTACTGGAGGTGAACCTCCATTTCTGACATCCTCTCAAAGTGGCTCTATCCTGTTTATGACATTGTCTAGCTC
AAGACTTTCTGCACAAATAATATCCCGATCCTGTATCTTGAGTGTTGAGTTTCAAACCCAGGGCCTTTCACGTACAAGGC
AAACTANCACTCTACTACTGANCTACGGGAGCANCACCCTCCTACATACAGATTGGTCTTCNNTTTACCCTGTANGCCTC
TCANGCCTTAAACTTGTGATTCACTTGCCNCAGCCTCCCANACNGGANTACNGTCCTGTGCCNCCANTCCTGGTTACTCT
TTNACTTN
Sequence Type genomic DNA
Unitrap ID UNI31092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117561576..117561982 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]


Sequence tag IST14397E10BBF1
Sequence
CAGGGCTTTGTATGGGGTCTACAGAGTAAGGGATTATCAAAGCCTTGTCTCAGANACTGCCATCACTGGGTGTTACCTAT
TAGAAATGCACATTTGTGACTTCTATCTACCTTACCCAACAAGTCAGGTTCTTTGGAGATGATTCCTATGTGTGCTCTAA
TTTCATGTTTGTTTGACAAAAGGATTACCTTTTTATATAGAACCCTGTTCAGCTGGAGAGCTATTACAAGATATGCAACA
CGGGAGAATTCTGCTTTAAAAAGTCNAGATAGCCNACAGCTGGGTGTTGGGAGGCNATAGCCCANGTGGTTNATGTCANT
GGGGTGGGCACTATCTCCTGANCGCTCCACGCTCTCCTCTCCTTCANTCNNCACCACAGGGAGCTTTCCCCTTGGTANAG
GTACTGCNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117561174..117561580 383
NO GENE  

 
Come back to gene ENSMUSG00000025571


For any suggestions or comments, please send an email to unitrap@crg.es