Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_311F04-3
Clone ID CMHD-GT_311F04-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_311F04-3
Sequence
ACCTGAAGTGTATCTTCTAGTATTGTTCGGATTTAGTGCCCTTTGACTCCTGGAACCGTCTCATGCGGCAGTTGGGCCTC
ACAGACAATCAAATCCAAATGGTCAGAGCCGAAACACTGGTCACACGTGAGGCCCTGTACCAAATGCTGCTCAAGTGGCG
CCACCAGACTGGGCGAAGTGCCTCCATCAACCATCTGCTGGATGCCTTGGAAGCCGTGGAAGAGAGAGATGCCATGGAAA
AAATTGAAGACTACGCAGTGAAATCCGGGAGGTTTACTTATCAAAACGCTGCAGCCCAACCAGAGACAGGGCCAGGAGGA
TCTCAGTGCGTTTGAAGTCAGCCTGATCTACTTAGTGAACTCAGGACAGCCAAGGCTATGTAGAGAGCCCCGAAGATGCA
GGCTCTTCAGTATTATGAGAATGTACTTAATTTTTTCTTGTAATAATTAAAGTATCAAATTATTGTATTATTTATATTAT
TACTGTTAAGTACTATGTTCTCTTATTAGAAGTTGAACACAGAACCTCTGAGAACACAGATGCTACAAGTGTTCTAACAC
ACCTCCAGCATCCCGGATTACCTTTGTTCCTGAACAAGGCACAATTGGTAGGGTATGATAGGGCCTGCCTATCATCCTAA
CACTCCGGTGATGGAGCCAGGAAGATCAAGAGTTCGAGGCCAGCTGGTTCACATAAGATCCCATATAATGTGCAGGATGG
CTAAACTTGCTGAGAGCTGACTCTGTGGTCTCCTGTCCC
Sequence Type mRNA
Unitrap ID UNI13590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70182039..70182797 733
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022074 (Tnfrsf10b) NM_020275 tumor necrosis factor receptor superfamily, member 10b Gene [Source:MGI Symbol;Acc:MGI:1341090]

 
Come back to gene ENSMUSG00000022074


For any suggestions or comments, please send an email to unitrap@crg.es