Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_287F10-3
Clone ID CMHD-GT_287F10-3
Vector pMS3
Project cmhd

Sequence tag CMHD-GT_287F10-3
Sequence
ATGACGTTGGTGTGCTCCCTCCTGTTCATGCAGACGTGTGATGTAAGACACCAGATGCCATAGGTTGCGAGGATGTAAGA
TCGTCTGAAGGCTTCCGCACCCTCTCCTCCAGGGTAAGGCAAATGCGCTCCGTTTCACTGGCTTCGTTGAGTCATAGATG
CTCTTGTCTCAGCAGAGTCTTGGAATTGGTGCAGTGAGATCCTGTCTGTCTGTGAGAGGCTTCTAAAGCTTGCTTTATTC
AAATCACGGACTCAAATCAAAATGTGTGAACAATGGTGACCAAGGGATGGGGATGTGTACTGTGCATGGAGACATCTCTA
CACACGGTGGTTGAGTGGGTTTGTATGGAGTGTGATTTGTAGGAGCAGAGCAAGAGAGAGTTCGAGACCAGCTGCCTTTT
GCCTGAAGCCCTATCGTATTGCGAATAGTCTGGTCAGAGGTCCCTTCCCGCCGTCCTCCGCTTCCGTGAATCATTCCCTG
AACGTTTCCTTTACCGATTGCTGTTCCTGAAGGAAGTGGCTTGTGAGAGCCGAAGTCCCTGGTGTGGTGGTCCGTAGCAG
CTTAAATTAAGCTCATCGTTCCACCCACTAGTAGCTTCCTATCTTGTATCTCACGAAGCCATGTGCCTAGCCGCTCAGCT
GCCTGTAGTTGCAGGTATCCTGTATGTGCCTACAAGGTGCTTGGTAACCAATCCTGGCTTGAGGTTTTGTTTGTGGCC
Sequence Type mRNA
Unitrap ID UNI13591

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103654580..103655291 666
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042757 (Tmem108) NM_178638 transmembrane protein 108 Gene [Source:MGI Symbol;Acc:MGI:1932411]

 
Come back to gene ENSMUSG00000042757


For any suggestions or comments, please send an email to unitrap@crg.es