Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10881A7
Clone ID IST10881A7
Vector VICTR76
Project tigm

Sequence tag IST10881A7HMR1
Sequence
NNATTATATAATTNAATTAATCCTAAGCAGAAAAATAAAAGAAATTCCATTACCTGTCAGAACCCGGGTGAAATTCTGAA
AGCAAGGAAGGTCGTCTTCGAAGCTGCTGCTGCTGCTGCTGCTGCTGTAAAAGCTGTGATGCCTGGCTAACTTCAATATG
AGAAGAGCGGTAGTCAGGAACTGCAAATTCCTGGTATTAAAATAATTGTCANTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62247014..62247225 208
 
EST/CDNA Est Name
  BQ569134.1 - AL363894.1 - BE376542.1 - CB236664.1 - CA532191.1 - CK333484.1 - CB237259.1 - DV055403.1


Sequence tag IST10881A7BBF1
Sequence
ATAATTTATTTATATTTTTAATTTTTAAAAAAGGTTTATTTATTTATAATATGTGAGTACACTGTAGCTGTCTTCAGACA
TTCCAGTAGAAGGCATCAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62246916..62247018 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es