Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14548B5
Clone ID IST14548B5
Vector VICTR74
Project tigm

Sequence tag IST14548B5HMR1
Sequence
AAAGAAGTCTTCCCTACCCCATCACCCTGCTCCCANAGGCAGGAAAAAAACCTAGCTCCTGGCTCCCAGCCTTGGGAGCC
CTAGGCTTCGGTGATCTAGGAAAGGAGAGGTGAAGTTGGGCCCTCTCAGCAGCTTCCAAGGACTTGTGCTGCCCCTGCCC
CTGAGTCTTCAGGGAGGGGAGGATGCTGTGCTTAAGTAACTTTGTTCTGTGCTTTGTGAAAGGTAC
Sequence Type genomic DNA
Unitrap ID UNI24232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35090983..35091207 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066571 (4931406P16Rik) NM_172741 RIKEN cDNA 4931406P16 gene Gene [Source:MGI Symbol;Acc:MGI:1924311]


Sequence tag IST14548B5BBF1
Sequence
CTTTAACCATAACTGAATCTCATTAGTATCTAACCCCCAAGTCATTCTGAGTATGAAAATGTGACTGTTTTCCTGCTAGT
ATCTAGCTCTAAGTCTACATTCAAATCTTCCCATTGCTGGCAGAGCTCTGTAAGTTCCAGGTCAGCCTGGTCTAAACAGC
AAGGTTCAGACCTGCCAGAGCTCCACAGTGAGTCAGTGGGCCAAGCTGCTTGTTCCCAAGCCTGATGATCTGATTTCGAT
CCCAAGACCCACAAATGTAGAAGCCAAAATCCAATTCCTACAGACTGTCCTCTGACATCCACACGTATACCACAGTACTC
ATGCCCACACATACACACAAATAAATTTTCAAATGTAATTTAAAAAATTTTTAAAGGTGGGCTGGTGAGATGGCTCAGAG
GGTAAGAGTACTGACTGCTCTTCTGAAGGTTCTGAGTTCAAATCCCAGCAACCACATGGTGCTCACAACCACTCGTGTAA
TGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35091204..35091692 489
 
EST/CDNA Est Name
  BY193046.1 - BY726416.1 - BI854963.1 - DV069077.1 - BY718529.1 - CN688149.1 - BQ561049.1 - CA566544.1 - CD548686.1 - BY152878.1 - BY303741.1 - CD550638.1 - BY121798.1 - CJ087430.1 - CJ078068.1 - BB575695.1 - BY124837.1

 
Come back to gene BY193046.1 - BY726416.1 - BI854963.1 - DV069077.1 - BY718529.1 - CN688149.1 - BQ561049.1 - CA566544.1 - CD548686.1 - BY152878.1 - BY303741.1 - CD550638.1 - BY121798.1 - CJ087430.1 - CJ078068.1 - BB575695.1 - BY124837.1


For any suggestions or comments, please send an email to unitrap@crg.es