Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13052E7
Clone ID IST13052E7
Vector VICTR76
Project tigm

Sequence tag IST13052E7HMR1
Sequence
CCCCAACAGTAGACGCAAAGATTAAAAATCTTTATGGGTATGGTACCTGTAACATGTCAGCCAGCCAGCTTGATTTTTTT
TATGTTAGTGAAAGTCATTATTATTCNNACAAAACTTTAGTACTCAAATAATTTACGTANAATACTTGGCTTCTACGAAT
TANAACTCTTATTTTGGGACATTTGCAGTTGTAATTTAGGGAGAAATAGGTGTTAAGAGGCTATACTATTATANAAAGAT
GTTTTTACTTGTTTGTGTTTAGAGGANAATTNANAGGTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI16561

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108835552..108835844 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071180 (2810008M24Rik) NM_001048250 RIKEN cDNA 2810008M24 gene Gene [Source:MGI Symbol;Acc:MGI:1922866]

 
Come back to gene ENSMUSG00000071180


For any suggestions or comments, please send an email to unitrap@crg.es