Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15005D11
Clone ID IST15005D11
Vector VICTR78
Project tigm

Sequence tag IST15005D11BBF1
Sequence
GTACTTTTGTGTTTTTCGAGTATCTGTGGAATATTTACAGAGGTTTTCAAGTGCCCACCGATGTTTCCCAAGGTCCTTAA
TGCCCAAATTGANAGATNANGAATTACNNNTANAANAGAGTCNATTGTTTCTATTCANAGTACNANAAANCTGGANGGGT
GN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15005D11HMR1
Sequence
CNATTTCTATTTCTGGGATCTAAAATGTAAAATGTATCTCTTAACTCAATTTTGTTAATGATATTAATTATATCCTTAGT
TGTCTGTCTCCATTTAGTCTATTCAATGCTCGGGCCTCTGTCTTGTCTGTTGCCATTGTTTTGGTGTCTCTTGGTGCTGT
TAANTGGACACAGATATTCATTATAAATCTTCACTGTGGATTGTTCTCTTATGTTATCAAGTGTTTGTCTTTGCCATCCA
NANAGCTTCTGTCTTGAATTTANCCATGACTAATACTAANGANGANCTCTCTCCTTATTTTATTTTGN
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55002318..55002622 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es