Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14508C6
Clone ID IST14508C6
Vector VICTR74
Project tigm

Sequence tag IST14508C6BBF1
Sequence
GTGACCTATCCCACCCTCACCACTCCAAGTGCACCCCTCCTAAAACTGCATCTCATCTCAAGAGAATGACTTTCTTGGCA
GAGCACGGCCATTTTTGGTCAGGTGTACAGGTGCTGTGCCCCCCAGCCAGAACCTCCAAACAAGCTCTCAGACACAGCAG
ATCCAAACTGTAATGAGGATCTTTCTTCAAAAACCATTTGTTTTCGTGGTTTTGTTATTCTGAGATAGGCTCTCACTNNN
NNNNNNNNNNNNNTTGAACTCAGGATCTTTCTCAGCCTCACAGGTCTGGGCCTCACAGGTGTGTACCACTGTGACAAAAA
GTGAGCTCNANTTTATGTGCTGATGATTGTACCAGGGACANAACACAGTGCCTTGCATGTGCCAGGACTG
Sequence Type genomic DNA
Unitrap ID UNI17009

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164587244..164587634 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017299 (Dnttip1) NM_133763 deoxynucleotidyltransferase, terminal, interacting protein 1 Gene [Source:MGI (curated);Acc:Dnttip1-001]


Sequence tag IST14508C6HMR1
Sequence
NATGCCTAGCCTGACAGATNACTGTAGTACACAACTCCAGGCACCACTGGGGTGGCATCTGTTGTANCNAGATGGCCCTC
ATATCCTAGATAAGCTGTGTTTGACATGCCTGGGCAACTTCAGGCAGCAAGCAGGAAGGTGTTTCAAGGTTGAAAGCTGA
AGGTGTGAGAAGGACAAAGAAACCTGGGAAGCCTTCGGAAGACCTGGTCCTGAAGTCCTGTGGATGANAAAGATCCCTGT
GCCCACGGTGGTCACGAGGCNCCNNANGTCTTACNNAGGATGAGTTTCNNTTCTNNCATTCNTACCAGGCANCTTACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017299


For any suggestions or comments, please send an email to unitrap@crg.es