Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11151B4
Clone ID IST11151B4
Vector VICTR76
Project tigm

Sequence tag IST11151B4BBF1
Sequence
ACTTTTTTATGCTGATGCTTATTTGACTTAACTTTANTGACCTCTGTTTTGTTTTGTTTTGTTTTGTTTGTTTTGAGACA
GGATTTCACGATAACTCTGGTTGTCCTAGAATTCACTGTGTAGACCAGGTTGGCCTCAAACTTACAGAAATCTGCTTGTC
TCTGCCTCTTGAGTGCTGGAATTAAAAAGTATGTGCCACTATGCCTGGCTTGACCACTGTTAATTTTTAATTGAAGGCAT
GGGACTGCAATTCTAATTANAAAGTGTTTTCTANAGCCATATGTAATGGTACATACCATTTTGTGTGTTAGTTTGAGTCA
GGCCCTGGCTGTCCTGGAACTCACAATGTANACTAGACTGGGTTCAGCTCCCCTCCTGCTCTTACCTCTTGAGTGCTGTG
TTTATAGGCNAGCCTGACTGTTAGGAAGCCNATTNAGATGGTTTCAAGTNAGANTAGAGATTTTTATGTTGTTGTTGAGA
ATANNTCCTATTATGTATTTCTGGCTGGCCTCGAACATGCTCTATAGNCCANGCNAGTCTCAAACNCACAGTGNNCCANN
TGACN
Sequence Type genomic DNA
Unitrap ID UNI33714

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86601611..86602174 526
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]

 
Come back to gene ENSMUSG00000018425


For any suggestions or comments, please send an email to unitrap@crg.es