Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14631G1
Clone ID IST14631G1
Vector VICTR74
Project tigm

Sequence tag IST14631G1HMR1
Sequence
GCGGGCAGCCNAGGCAGGAGAGAAGACCATCTCTGTGGTCCTACAGGTGATGCTGCCATCTCCCACCTCCTCATTCCCGG
GGCAGTGAGACCCCCGCTCACATTCCACTGCCAGCTGGCTGGAGGTTGAGTCGTTTCCTTTCTGTAGTAGAGAGCTTGCT
CGGCTAACTTGCCTGGAAAATGGGCTTANAAATCCCTGTGCCTCCAGGAATCCTTGGGTAACCCTGANTANGTTC
Sequence Type genomic DNA
Unitrap ID UNI23270

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25332856..25333089 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051768 (Xrcc1) NM_009532 X-ray repair complementing defective repair in Chinese hamster cells 1 Gene [Source:MGI Symbol;Acc:MGI:99137]


Sequence tag IST14631G1BBF1
Sequence
AGGCGTGGAGGGAGATATTGGTTCCTGAAGCCTGTTGGGGCAGGACCCTGAACACCTTTGTTCTTAGACACTAAGGTCGA
ATCCAGGCAGTTCCCTGGTGCCCCACCCTTTCACCTCTTTAGTCATTCAGACTTTCAGGAGTATGTACACTGGGTGGCTG
AACCTGGCAATGAGGGGCAGCATTCAGAGAGAAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163288231..163288428 198
NO GENE  

 
Come back to gene ENSMUSG00000051768


For any suggestions or comments, please send an email to unitrap@crg.es