Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10831C4
Clone ID IST10831C4
Vector VICTR76
Project tigm

Sequence tag IST10831C4HMR1
Sequence
GCAACACAGTGTCTGAGAAAGGTCCTGTTTTGGGCCATCTTCTTCGGCCNGGAGGAGGTCCAAATACAAGATATCTGCGC
ACCTTCCCTGTAAGAGAGCTTGCCAGCAGAGAGTGCTCTGAGCACTGAAACTCAGAGGANANAATCTGTCTCCCAGGTCT
GCTGATAGACGGTAACAGAATCACCAGAAGAACAATCTCTAAACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI33719 UNI33720 UNI33721

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 35979783..35979992 204
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 59275656..59275865 204
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35442892..35443101 204
 
EST/CDNA Est Name
  W63990.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 65105201..65105410 204
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59208560..59208769 204
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14003920..14004129 204
 
EST/CDNA Est Name
  CA748406.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 16286423..16286632 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048834 (Vstm2a) NM_145967 V-set and transmembrane domain containing 2A Gene [Source:MGI (curated);Acc:Vstm2a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16370392..16370601 204
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 127650656..127650865 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051900 (Abca16) ATP-binding cassette, sub-family A (ABC1), member 16 Gene [Source:MGI (curated);Acc:Abca16-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 64049116..64049325 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079500 (AC114408.18) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8CC18]

 
Come back to gene ENSMUSG00000079500


For any suggestions or comments, please send an email to unitrap@crg.es