Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12744A9
Clone ID IST12744A9
Vector VICTR76
Project tigm

Sequence tag IST12744A9HMF1
Sequence
TCACCTGTTCAGACTAATTTCCTAAGTTCGTCGGGTCTCGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTANGCCGCC
TCCCCAGCCGGACGGGCACCTGTCCTCCGGTCCGGACGGTGGCTGGCTGTCCCCGGCCCACAAAGGGTGCTGCCTCAGCG
CCTCTGTGCTTCCGCCTGTTCCAAAAGCTGTCAGGTTCTCTGGCGTACCCTCTCACCTGTTCANACTAATTCCCTAANTT
CGGCGGGTCCCGGACCAANATGGCNACCGCTGCTGCTGTGGCTTANGTCNCCTCCCCAGCCGGGCGGGCACCTGTCCTCT
GGTCCGGAAGGN
Sequence Type genomic DNA
Unitrap ID UNI22185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11188007..11188337 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020193 (Zpbp) NM_015785 zona pellucida binding protein Gene [Source:MGI (curated);Acc:Zpbp-001]

 
Come back to gene ENSMUSG00000020193


For any suggestions or comments, please send an email to unitrap@crg.es