Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12051A5
Clone ID IST12051A5
Vector VICTR76
Project tigm

Sequence tag IST12051A5BBF1
Sequence
CAAGCTGAACCCAAGTCCAGGTACCAACGGGGCCCATCACGAACCGATTACTTTCCTTGACCCCCTCTGTATTGTTAAGC
CATTGCAGCCCACTGTAGCGCGTCTGTGGCCCTGTCTTTCTTCGTATTCGAGCGATGGGAATGTACCACGTACTGGTACA
TTTTTACCTTCTGCAGGTGCCCTAGCACCCAATATTTTGGAATGGGGGGGGGTGGTGGAAAATCNATCCCAAATCTGAAG
GTTTCCCCCACCTANACCTTTCCTGCACATGTGAAATTGGTANAGTTTTGAANANTCNTACCCACCCTAACCCACCCGCA
TATAAGGTTTGGAGGTTCAAGTGTTTGGGTTGGAAGGGGCTCTAACTCCCCCCCCTCCCNNNCGGNCCCGTACTTTTNNN
AGCGCCTTCCCAGCTGTCNCTGAANCTGCATTATTNNTCNCTGTCTTTNNNCTNAAAAANAAACCCTTCTGATCNCANNC
CGGGTGTANNNACNAANGCTGGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12051A5HMF1
Sequence
CAAGCTGAACCCAAGTCCAGGTACCAACGGGGCCCATCACGAACCGATTACTTTCCTTGACCCCCTCTGTATTGTTAAGC
CATTGCAGCCCACTGTAGCGCGTCTGTGGCCCTGTCTTTCTTCGTATTCGAGCGATGGGAATGTACCACGTACTGGTACA
TTTTTACCTTCTGCAGGTGCCCTAGCACCCAATATTTTGGAATGGGGGGGGGTN
Sequence Type genomic DNA
Unitrap ID UNI23732

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68885846..68886058 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020895 (Tmem107) NM_025838 transmembrane protein 107 Gene [Source:MGI (curated);Acc:Tmem107-002]

 
Come back to gene ENSMUSG00000020895


For any suggestions or comments, please send an email to unitrap@crg.es