Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_272E7-3
Clone ID CMHD-GT_272E7-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_272E7-3
Sequence
TTGGACAGAGAGAGTCAGAAGATGTGAAAGAAAAAGACCGAGCTAAAGAAATGGCAGCCAGTTCCACAGTTGTTGAAGAT
ATCACAAAGGACGAGCAGGAGGAAACACCGGAAATAATCGAACAGATCCCTGCTTCAGAGAGCAATGTGGAAGAAATGGC
GCAGGCTGCTGAGTCCCAAGCTAATGACGTCGGCTTCAAGAAGGTATTTAAATTTGTTGGTTTTAAATTCACGGTGAAGA
AGGATAAAAACGAAAAGTCAGATACCGTCCAGCTACTCACTGTCAAGAAGGATGAAGGCGAAGGGGCAGAAGCCTCCGTC
GGAGCAGGAGACCACCAAGAGCCCGGAGTGGAGACCGTCGGCGAATCATCATCCAAAGAAAGTGAGCTGAAGCAATTCCC
CAAGAAGCAAGAAGGCCCCCTGA
Sequence Type mRNA
Unitrap ID UNI486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5992977..5993399 411
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es