Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15052D3
Clone ID IST15052D3
Vector VICTR80
Project tigm

Sequence tag IST15052D3HMR1
Sequence
NGGGACCNGGCAGGCGACGCGGGATGGAGTGTACGAAGGGGGAGACTACACAAAGGAAGGCCGTGGGCCTCAGGATTTCC
CTTTTCCTACCTGTAGGCGCCGCAGCAAATGGGATCAGCCAGCGCCAGCTCCGCTTCTCTTCCTGCCGCCAACGGCCCCA
GGTGGAGAAGTCGCTGGCAGCGGGGCGAGCCCCGGGGGCGCCACCACCGCCGCCGCTCCTTCAGGAGCCTTGGATGCCGC
CGCTGCCGTGGCTGCCAAGATCAATGCTATGCTCAT
Sequence Type genomic DNA
Unitrap ID UNI2992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88490170..88490445 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]

 
Come back to gene ENSMUSG00000028060


For any suggestions or comments, please send an email to unitrap@crg.es