Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11007A3
Clone ID IST11007A3
Vector VICTR76
Project tigm

Sequence tag IST11007A3HMF1
Sequence
CATGGTGGCTCACAACCACCTGTAACAAGATCTGATGTCCTCTTCTGGCGTGTCTGAAGACATACAGTGTACTTAG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13119727..13119802 76
NO GENE  


Sequence tag IST11007A3BBF1
Sequence
CATGGTGGCTCACAACCACCTGTAACAAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI16700 UNI29852 UNI30252 UNI30938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13119769..13119802 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81381791..81381824 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 41164930..41164963 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 25374504..25374537 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066553 (AC125067.4) Cox7a2l protein [Source:UniProtKB/TrEMBL;Acc:Q99KD6]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4264825..4264858 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 90112888..90112921 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 122383915..122383948 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86482519..86482552 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137833037..137833070 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030852 (Tacc2) NM_001004468 transforming, acidic coiled-coil containing protein 2 Gene [Source:MGI Symbol;Acc:MGI:1928899]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33296022..33296055 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037426 (Depdc5) NM_177786 DEP domain containing 5 Gene [Source:MGI (curated);Acc:Depdc5-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 110379788..110379821 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71172231..71172264 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20651050..20651083 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74764075..74764108 34
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es