Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11826H5
Clone ID IST11826H5
Vector VICTR76
Project tigm

Sequence tag IST11826H5BBF1
Sequence
AGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCA
TAACCATCCGTAACAAGATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI33722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 34682..34786 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 15112..15216 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30291792..30291896 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 95334500..95334604 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23723919..23724023 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22212344..22212448 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23903256..23903360 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028973 (Abcb8) NM_029020 ATP-binding cassette, sub-family B (MDR/TAP), member 8 Gene [Source:MGI (curated);Acc:Abcb8-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 63977534..63977638 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103316330..103316434 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18334228..18334332 103
NO GENE  

 
Come back to gene ENSMUSG00000028973


For any suggestions or comments, please send an email to unitrap@crg.es