Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10548H10
Clone ID IST10548H10
Vector VICTR76
Project tigm

Sequence tag IST10548H10BBF1
Sequence
ATTCTTGGCTCTCCAGCTCCCACGATGGGATATATGGAAACTTCTAGAAACAGCTGAAGACAATCCAACATGGAAAGCAA
GCAAAACTCCACATTGAGAATACAGGATGTCCAAGAACATACCACCCTGAATGTGGGTGATCTCATCTGATCTCTTAGAC
TCTACACAGCGTCAGACCTGACTGGTGCTTAGATGGGAGAATATAAAGAGGAGTCGCTGTGCAGGGATTCTTGCTGATAA
CTCATTTATTTACAGATTTTTATTTATTTTTTAAATAATTATTTATTTATTTTATGTATATGAGCACACTGTAGCCGTCT
TCAGGCACACCAGAAGAGTGTGTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104141797..104142145 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST10548H10HMR1
Sequence
NGNNGGCAGAGGCAGGTGCATTTCTGAGTTCGAGGCCACCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACAC
AGAGAAAGCCTGTCTCGAAAAACCACAAAACAAAACAAAACACAAAAACAAAAGAAAACCCCGTCATATGATGAGCCCCT
ACCTTGGATAACCGTAATTACATTTTTCATTTATGCCAGGAATAGAACCCAGTGCCAGCAGCAGGCTAAGCCCACCTTTA
ACTAGTGAGCTTACACTCCCACCCCCTCATTAACATTCATTGAGTTCTTGATGTGTGGCAAATAACTTTATCTTGCCTGG
GTCATCTCATTTGATGCNNNNNNNNNTCCTTTGTGGTGGGGAGTTTTTGGTCACCGTANTTGAGAATAGGAGATTAAAGT
GCCNANTATTGAATGGCTCAGAGAGGTTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI23108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122589901..123228129 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029471 (Camkk2) NM_145358 calcium/calmodulin-dependent protein kinase kinase 2, beta Gene [Source:MGI Symbol;Acc:MGI:2444812]

 
Come back to gene ENSMUSG00000029471


For any suggestions or comments, please send an email to unitrap@crg.es