Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15019C6
Clone ID IST15019C6
Vector VICTR78
Project tigm

Sequence tag IST15019C6BBF1
Sequence
CTGACCTTCGGAAGAGCAGTCAGGTACTCTTACCCATTGAGCTATCTCACCAGCCCGAGTTTTACAAATTTTAAGTGCTT
ACCAGGACTGGAGAGATGGCCAGCAGTTAAGAGCCCTGACTGTTCTTCCAGAGGTCCTGACTTCAATTCCCGGCAACCAC
ATGGTGGCTCACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCAACGGTGTACTCACATC
CNTGAAATAAATNANNAAATAAATCTTANAANAAAGTTTNNNTGCTTACCNCCTACCNTATTCCNNNGGANACTGTTTGG
AGGGTGTGTGTGTGTNTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15019C6HMF1
Sequence
CTGACCTTCGGAAGAGCAGTCAGGTACTCTTACCCATTGAGCTATCTCACCAGCCCGAGTTTTACAAATTTTAAGTGCTT
ACCAGGACTGGAGAGATGGCCAGCC
Sequence Type genomic DNA
Unitrap ID UNI17261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72672223..72672326 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es